elektrik port üyelik servisleri elektrik port üyelik servisleri

1 Gramı 900 Terabayt Olan Canlı Sabit Disk

Günümüzün en büyük ihtiyaçlarından olan veri depolama problemi kullanılmakta olan geçici ve kalıcı hafıza birimlerince giderilmeye çalışılmaktadır. Ancak artık durum biraz değişecek. Yeni geliştirilen canlı sabit disk besleniyor, çoğalıyor ve veri depolama kapasitesini arttırabiliyor.



A- A+
06.12.2010 tarihli yazı 3554 kez okunmuştur.

Günümüz insanlarının yanlarından ayırmadıkları şeylerin başında flash diskler, usb bellekler ve son dönemlerde de taşınabilir harddiskler gelmektedir. Bunlardaki ihtiyaç ise giderek artan veri depolama, eski bilgilerin, fotoğrafların ve videoların saklanması isteğinden kaynaklanmaktadır. Her ne kadar bugün terabaytlara kadar çıkılsa da yine yetersiz kalınmaktadır.





Canlı sabit disk' Evet ilk duyulduğunda verilen tepkiler hep aynı. Ama teknolojinin sınırı olmadığının en güzel kanıtlarından birisi. Aslında mikroorganizmalar üzerinde veri saklama fikri yeni bir olay değil. Yıllardır üzerinde çalışılan bir konu. Ama bugüne kadar somut bir proje ortaya çıkmamış derken 2010 yılının sonlarına doğru gelen haber herkesi heyecanlandırdı. Hong Kong'lu bir ekip E. Coli adı verilen bakteriler üzerine bir bilgisayarın tüm hafızasını dolduran veriyi DNA dizilimi şeklinde aktarmayı başardı.








Yaşayan bakterilerden en basit olanları bile çok uzun miktarda baz diziliminden meydana geliyor. Bakteriler canlı ve çoğalma yeteneğine sahip. Dolayısıyla üzerlerine aktarılan verinin kopyalanıp çoğaltılması oldukça kolay oluyor ve kopya sayısının istenilen kadar olması sağlanabiliyor. Ayrıca mikroorganizma canlı olduğu için dayanıklılığı da çok yüksek ve veri kaybolması, bozulması gibi problemlerin yaşanması durumu oldukça azalıyor.





Prensip olarak herkesin lise yıllarında öğrendiği adenin, guanin, sitozin ve timin baz dizilimi kullanılıyor. Oldukça basit olan bu sistemde 4 adet baz kullanıldığı için tüm sistem 4'lük sayı tabanına göre tasarlanmış olup dizilimler ona göre yapılıyor. Dörtlük sistemde her rakamın karşılığı olan bazlar ise 0=A, 1=T, 2=C, 3=G şeklinde belirleniyor. Örneğin dörtlük sistemdeki 1203 ün karşılığı TCAG oluyor. Eğer karakter bazında çalışılacak ise ASCII tablosundan yararlanılarak karakterlerin 7 bitlik ifadeleri 4'lük sisteme oradan da DNA dizilimine dönüştürülebiliyor.





1 gram bakteride maksimum olarak 931,322 Gigabayt yani yaklaşık olarak 900 Terabayt veri saklayabilmek mümkün oluyor. Ama artan depolama ihtiyacına göre kullanılan bakteri sayısı da değişebiliyor. Örneğin uzmanlar gerçekleştirdikleri bir projede, Amerika'nın Bağımsızlık Bildirisini 18 adet E. Coli bakterisine yerleştirebilmişler. Şu an da uzmanlar, canlıya zararı olabilen ve tekrarlanan uzun dizilerden kurtulabilmek için çeşitli algoritmalar üzerinde çalışıyorlar.







Şimdi bir örnekle durumu açıklayalım. Örneğin 'ELEKTRİKPORT' verisini canlı bakteri üzerine aktarmak istediğimiz zaman karşılaşacağımız durumlar şöyle:



Verinin 4'lük sistemdeki ifadesi



101110301011102311101102103001023110010331102111002000031



Verinin DNA kodunun ifadesi



TATTTAGATATTTACGTTTATTACTAGAATACGTTAATAGGTTACTTTAACAAAAGT



Verinin sıkıştırılmış DNA kodunun ifadesi



TGCAGTCCTGAGGGTTTGATGGTTAAGCAACTGGACGGTAAAGCGGAAAAGGAACCTTATGCAAAATTAAAAATGCCCAAAAA



GGAGC



Görüldüğü gibi alışılagelmiş veri depolama sistemi değişerek, yerini artık canlı, beslenebilen, çoğalabilen ve daha dayanıklı veri depolama sistemlerine bırakacağa benziyor. İlerde kim bilir belki her insan istediği kadar veriyi kendi üzerinde depolayabilir.



Elektrikport / Emre MERSİN


ANKET
Endüstri 4.0 için En Hazır Sektör Hangisidir

Sonuçlar